View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15126_low_58 (Length: 221)

Name: NF15126_low_58
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15126_low_58
NF15126_low_58
[»] chr2 (1 HSPs)
chr2 (16-206)||(8084568-8084759)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 8084568 - 8084759
Alignment:
Q  16 atgaataactctacctatttttgttgatggataaattaaataacaattagc-taggaacttagaatggtgcttaggatatcagctagcatttagcatgca 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||    
T  8084568 atgaataactctacctatttttgttgatggataaattaaataacaatttgcctaggaacttagaatggtgcttaggatatcagctagcatttagcatgca 8084667  T
Q  115 gttgatgatgagaactttgaggtccaatacttttcaatatcttctggggttcttccagggattcttccagcaatgagatgccatctacaatt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8084668 gttgatgatgagaactttgaggtccaatacttttcaatatcttctggggttcttccagggattcttccagcaatgagatgccatctacaatt 8084759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University