View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15123_low_21 (Length: 202)

Name: NF15123_low_21
Description: NF15123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15123_low_21
NF15123_low_21
[»] chr7 (1 HSPs)
chr7 (47-187)||(42890754-42890894)


Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 47 - 187
Target Start/End: Original strand, 42890754 - 42890894
Alignment:
Q  47 tagtgttattggtttgttttggagctctaacgtggtttgggtagcaattgtcatgatatgcatttagtttttgtatcagtgggtatgcgtttgctctttt 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42890754 tagtgttattggtttgttttggagctctaacgtggtttgggtagcaattgtcatgatatgcatttagtttttgtatcagtgggtatgcgtttgctctttt 42890853  T
Q  147 atttattcgttgcacataatgtgcctagtttggatcctatg 187  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  42890854 atttattcgttgcacataatgtgcctagtttggatcctatg 42890894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University