View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15123_low_18 (Length: 229)

Name: NF15123_low_18
Description: NF15123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15123_low_18
NF15123_low_18
[»] chr6 (1 HSPs)
chr6 (23-213)||(21852969-21853160)


Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 23 - 213
Target Start/End: Complemental strand, 21853160 - 21852969
Alignment:
Q  23 gcaagatgattcagtatcatatatactactctttatggagtagcatcaaagatgaatacaatgcgattaaagagaattcagtttggctgcttggcaaagg 122  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  21853160 gcaagatgattcagtatcatatatactcctctttatggagtagcatcaaagatgaatacaatgtgattaaagagaattcagtttggctgcttggcaaagg 21853061  T
Q  123 agataaaataaacttctgg-aatgactattggtgtggtcagtctcttgccactctttttaatatcgcagatcacatttctagtcttctcaca 213  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||  |||||||||||||| ||||||||||||||||||||||||||    
T  21853060 agataaaataaacttctggtaatgactattggtgtggtcagtctcttgcttctctttttaatatcccagatcacatttctagtcttctcaca 21852969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University