View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15123_high_9 (Length: 294)

Name: NF15123_high_9
Description: NF15123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15123_high_9
NF15123_high_9
[»] chr4 (3 HSPs)
chr4 (22-237)||(54918074-54918286)
chr4 (236-284)||(54917989-54918037)
chr4 (78-122)||(54911745-54911789)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 237
Target Start/End: Complemental strand, 54918286 - 54918074
Alignment:
Q  22 atgggaataaaaatttgtttgttttgatgcatgaatttaaaggtggcacaaaacatagaggaatttagtgacgaaagcatgagatcaaatggaaataaag 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54918286 atgggaataaaaatttgtttgttttgatgcatgaatttaaaggtgacacaaaacatagaggaatttagtgacgaaagcatgagatcaaatggaaataaag 54918187  T
Q  122 ccaaatgagacgaacattataaatccattgtgtctttgggaccttattcaagctggaacttttatatgagattatactagggttgttttgactaggtagc 221  Q
    |||||||||||||||   |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  54918186 ccaaatgagacgaac---ataaatccattgtgtctttgggaccttattcaagctggaactcttatatgagattatactagggttgttttgactaggtagc 54918090  T
Q  222 aagcacaaacttccac 237  Q
    ||||||||||||||||    
T  54918089 aagcacaaacttccac 54918074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 236 - 284
Target Start/End: Complemental strand, 54918037 - 54917989
Alignment:
Q  236 acgatttttgaatactagatgggatgaacaatggggtgatctgtctctg 284  Q
    |||||||||||||||||| ||||||||||||||||||||| ||||||||    
T  54918037 acgatttttgaatactaggtgggatgaacaatggggtgatttgtctctg 54917989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 78 - 122
Target Start/End: Original strand, 54911745 - 54911789
Alignment:
Q  78 agaggaatttagtgacgaaagcatgagatcaaatggaaataaagc 122  Q
    ||||||||||| ||| || |||||| |||||||||||||||||||    
T  54911745 agaggaatttaatgaggagagcatgggatcaaatggaaataaagc 54911789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University