View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_202 (Length: 216)

Name: NF1511_low_202
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_202
NF1511_low_202
[»] chr1 (2 HSPs)
chr1 (47-201)||(23693153-23693307)
chr1 (144-197)||(23747444-23747497)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 47 - 201
Target Start/End: Complemental strand, 23693307 - 23693153
Alignment:
Q  47 tagacatgtttatacaactaaatgtagttttaatacaatattcagcatttattttgaaatagttcaaaaattgtagaccagaacacagtttttcagcatt 146  Q
    |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23693307 tagatatgtttatacaactaaatgcagttttaatacaatattcagcatttattttgaaatagttcaaaaattgtagaccagaacacagtttttcagcatt 23693208  T
Q  147 ttcatcactaaaatttccaccatttcattttcagttgtaccaagcttgcctaaat 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23693207 ttcatcactaaaatttccaccatttcattttcagttgtaccaagcttgcctaaat 23693153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 23747497 - 23747444
Alignment:
Q  144 attttcatcactaaaatttccaccatttcattttcagttgtaccaagcttgcct 197  Q
    |||||||||||| ||| ||||||||||||||||| ||||||||||||| |||||    
T  23747497 attttcatcactgaaaattccaccatttcatttttagttgtaccaagcatgcct 23747444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University