View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_196 (Length: 227)

Name: NF1511_low_196
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_196
NF1511_low_196
[»] chr8 (1 HSPs)
chr8 (1-212)||(7211942-7212153)
[»] chr4 (1 HSPs)
chr4 (11-65)||(53233865-53233919)
[»] chr7 (1 HSPs)
chr7 (11-113)||(30618291-30618393)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 7211942 - 7212153
Alignment:
Q  1 aaaaattatataggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttaggggaacaagtgctgtgaccaactttgacataagta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7211942 aaaaattatataggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttaggggaacaagtgctgtgaccaactttgacataagta 7212041  T
Q  101 ggtatgatgtcaagagaatatgctcaagctcaactctaattaccggagatctcgcaaaacgttctcctaaagactctacccctcccgcaaccacagccga 200  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  7212042 ggtatgatgtcaagagaatatgctcaagttcaactctaattaccggagatctcgcaaaacgttctcctaaagactccacccctcccgcaaccacagccga 7212141  T
Q  201 ggacttcaattc 212  Q
    ||||||||||||    
T  7212142 ggacttcaattc 7212153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 53233919 - 53233865
Alignment:
Q  11 taggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttag 65  Q
    ||||||| |||||||| ||||||||||| |||||||||||||||||||| |||||    
T  53233919 taggcactcaagaagaagctgcagaagcgtatgatattgcagcaatcaaatttag 53233865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 113
Target Start/End: Complemental strand, 30618393 - 30618291
Alignment:
Q  11 taggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttaggggaacaagtgctgtgaccaactttgacataagtaggtatgatgt 110  Q
    ||||||| ||||||||||| ||||| ||||||||| | |||||||| || || || |||   ||||| || || ||||||||||| || || ||||||||    
T  30618393 taggcactcaagaagaggcagcagaggcatatgatgtggcagcaataaaattcagaggactgagtgcagttacaaactttgacatgagcagatatgatgt 30618294  T
Q  111 caa 113  Q
    |||    
T  30618293 caa 30618291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University