View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_193 (Length: 232)

Name: NF1511_low_193
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_193
NF1511_low_193
[»] chr7 (1 HSPs)
chr7 (16-216)||(48833815-48834015)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 48834015 - 48833815
Alignment:
Q  16 ttttatacaaaaatcaaatttacattctctcgaacaattcattttcatgagaaactcattaaccacctaatttcaaatacttggtttatgatttcactta 115  Q
    |||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48834015 ttttatacaaaaatcaaatttacattctcttgaacaattcgttttcgtgagaaactcattaaccacctaatttcaaatacttggtttatgatttcactta 48833916  T
Q  116 tattattttctatatcaatttgaattctgtcaactatgtttctttgcccatcatcagtttaccaatttacgaaattaggacaatattttgtaacttctat 215  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  48833915 tattcttttctatatcaatttgaattctgtcaactatgtttctttgcccatcttcagtttaccaatttacgaaattaggacaatattttgtaacttctat 48833816  T
Q  216 a 216  Q
    |    
T  48833815 a 48833815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University