View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_155 (Length: 249)

Name: NF1511_low_155
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_155
NF1511_low_155
[»] chr1 (2 HSPs)
chr1 (147-237)||(39382725-39382815)
chr1 (18-90)||(39382875-39382947)


Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 147 - 237
Target Start/End: Complemental strand, 39382815 - 39382725
Alignment:
Q  147 cacacgcttaatgagattgagagagtataccttcaagtgggatgagtttagagccagatttacagtaaacaaggccttgaacaccaatatt 237  Q
    |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39382815 cacacgattaatgatattgagagagtataccttcaagtgggatgagtttagagccagatttacagtaaacaaggccttgaacaccaatatt 39382725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 39382947 - 39382875
Alignment:
Q  18 aaatggttttaattttaaaacttacnnnnnnnntagttataatcttactaaaacattattacgggttttagaa 90  Q
    |||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||    
T  39382947 aaatggttttaattttaaaacttacaaaaaaaatagttataatcttactaaaacattattacgggttttagaa 39382875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University