View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15117_low_2 (Length: 338)

Name: NF15117_low_2
Description: NF15117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15117_low_2
NF15117_low_2
[»] chr8 (1 HSPs)
chr8 (15-232)||(4367339-4367556)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 4367556 - 4367339
Alignment:
Q  15 catcaagctaccaaaacatgaaaaagcttaaaccataacaccaattcaaacaacaatttacacatgcacnnnnnnnaacacaatttacacatgcacttaa 114  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||    
T  4367556 catcaagccaccaaaacatgaaaaagcttaaaccataacaccaattcaaacaacaatttacacatgcactttttttaacacaatttacacatgcacttaa 4367457  T
Q  115 aactaaaagataaacactagcatggaatcaaaaaatgaaccttttcaggaataacaaagccattgctatcttcttcaccagcattagccttatcaatgct 214  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4367456 aactaaaagataaacacttgcatggaatcaaaaaatgaaccttttcaggaataacaaagccattgctatcttcttcaccagcattagccttatcaatgct 4367357  T
Q  215 atgaccaccacgattaaa 232  Q
    ||||||||||||||||||    
T  4367356 atgaccaccacgattaaa 4367339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University