View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15115_low_18 (Length: 226)

Name: NF15115_low_18
Description: NF15115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15115_low_18
NF15115_low_18
[»] chr7 (3 HSPs)
chr7 (3-211)||(39984569-39984777)
chr7 (42-187)||(8101614-8101759)
chr7 (42-187)||(8018489-8018634)
[»] chr2 (2 HSPs)
chr2 (3-204)||(17706713-17706911)
chr2 (3-204)||(17649347-17649544)
[»] chr4 (2 HSPs)
chr4 (102-186)||(23597721-23597805)
chr4 (102-186)||(23588869-23588953)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 3 - 211
Target Start/End: Complemental strand, 39984777 - 39984569
Alignment:
Q  3 attaaggatgacaagattgcaggaaagcttgattccgatgacaagaagaagattgaggacaccattgaggctgctatccagtggctagatgctaaccagc 102  Q
    ||||||||||| || |||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||    
T  39984777 attaaggatgaaaaaattgcaggaaagcttgattcggatgacaaaaagaagatcgaggacaccattgaggctgctatccagtggctagatgccaaccagc 39984678  T
Q  103 ttgcagaggcggatgagtttgaggacaagatgaaggaattggaaagtgtctgcaaccctatcattgccaagatgtaccaaggtggtgcaggtcctgacat 202  Q
    |||||||||| ||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39984677 ttgcagaggctgatgagtttgaggacaagatgaaggaacttgaaggtgtctgcaaccctatcattgccaagatgtaccaaggtggtgcaggtcctgacat 39984578  T
Q  203 gggcgctgc 211  Q
    ||| |||||    
T  39984577 gggtgctgc 39984569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 42 - 187
Target Start/End: Complemental strand, 8101759 - 8101614
Alignment:
Q  42 gacaagaagaagattgaggacaccattgaggctgctatccagtggctagatgctaaccagcttgcagaggcggatgagtttgaggacaagatgaaggaat 141  Q
    ||||||||| ||||||||||  | |||||||  || || || ||||| ||||| ||||||||||| || || ||||||||||| ||||||||||||||      
T  8101759 gacaagaagcagattgaggatgcaattgagggagccattcaatggcttgatgcaaaccagcttgctgaagccgatgagtttgaagacaagatgaaggagc 8101660  T
Q  142 tggaaagtgtctgcaaccctatcattgccaagatgtaccaaggtgg 187  Q
    | || |   |||| ||||| |||||||| |||||||||||||||||    
T  8101659 ttgagacaatctgtaacccaatcattgcaaagatgtaccaaggtgg 8101614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 42 - 187
Target Start/End: Original strand, 8018489 - 8018634
Alignment:
Q  42 gacaagaagaagattgaggacaccattgaggctgctatccagtggctagatgctaaccagcttgcagaggcggatgagtttgaggacaagatgaaggaat 141  Q
    ||||| ||||||||||| ||  | ||||| ||||| || |||||| | ||   ||||||| | |||||||| ||||||||||| || ||||||||||||     
T  8018489 gacaaaaagaagattgatgatgcaattgacgctgcaattcagtggttggacagtaaccagttggcagaggctgatgagtttgaagataagatgaaggaac 8018588  T
Q  142 tggaaagtgtctgcaaccctatcattgccaagatgtaccaaggtgg 187  Q
    | || ||  | |||||||| ||||||||||||||||| ||||||||    
T  8018589 ttgagagcctttgcaacccaatcattgccaagatgtatcaaggtgg 8018634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 3 - 204
Target Start/End: Original strand, 17706713 - 17706911
Alignment:
Q  3 attaaggatgacaagattgcaggaaagcttgattccgatgacaagaagaagattgaggacaccattgaggctgctatccagtggctagatgctaaccagc 102  Q
    ||||||||||| |||||||||||||||||||||||| | |||||||| |   |||||||||||||||||||| |||||| ||||||||| || || ||||    
T  17706713 attaaggatgaaaagattgcaggaaagcttgattccaaagacaagaaaa---ttgaggacaccattgaggctactatccggtggctagacgccaatcagc 17706809  T
Q  103 ttgcagaggcggatgagtttgaggacaagatgaaggaattggaaagtgtctgcaaccctatcattgccaagatgtaccaaggtggtgcaggtcctgacat 202  Q
    |||||||||| |||||||||||||||||||||||||||   ||| ||||||||||||||||||||||||||||||||||||||||||| |||| || |||    
T  17706810 ttgcagaggcagatgagtttgaggacaagatgaaggaaccagaaggtgtctgcaaccctatcattgccaagatgtaccaaggtggtgctggtcttggcat 17706909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 3 - 204
Target Start/End: Original strand, 17649347 - 17649544
Alignment:
Q  3 attaaggatgacaagattgcaggaaagcttgattccgatgacaagaagaagattgaggacaccattgaggctgctatccagtggctagatgctaaccagc 102  Q
    ||||| ||||| ||||||||| |||||||||||||| | ||||||||||   |||||||||||||||||||||||||||||||||||||  | |||||||    
T  17649347 attaatgatgaaaagattgcatgaaagcttgattccaaagacaagaaga---ttgaggacaccattgaggctgctatccagtggctagaccc-aaccagc 17649442  T
Q  103 ttgcagaggcggatgagtttgaggacaagatgaaggaattggaaagtgtctgcaaccctatcattgccaagatgtaccaaggtggtgcaggtcctgacat 202  Q
    ||| | |||| |||||||||||||| ||||||||||||  |  | ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||    
T  17649443 ttgaataggcagatgagtttgaggataagatgaaggaaccgcgaggtgtcggcaaccctatcattgccaagatgtaccaaggtggtgcaggtcttgacat 17649542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 186
Target Start/End: Original strand, 23597721 - 23597805
Alignment:
Q  102 cttgcagaggcggatgagtttgaggacaagatgaaggaattggaaagtgtctgcaaccctatcattgccaagatgtaccaaggtg 186  Q
    |||| |||||| ||||| ||||||||||||||||||||  ||||  || | ||||||||||||||||| | |||||| |||||||    
T  23597721 cttggagaggctgatgaatttgaggacaagatgaaggagctggagggtatttgcaaccctatcattgcaaggatgtatcaaggtg 23597805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 186
Target Start/End: Original strand, 23588869 - 23588953
Alignment:
Q  102 cttgcagaggcggatgagtttgaggacaagatgaaggaattggaaagtgtctgcaaccctatcattgccaagatgtaccaaggtg 186  Q
    |||| |||||| ||||| ||||||||||||||||||||  ||||  |  | ||||||||||||||||| | |||||| |||||||    
T  23588869 cttggagaggctgatgaatttgaggacaagatgaaggagctggagggcatttgcaaccctatcattgcaaggatgtatcaaggtg 23588953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University