View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15108_low_27 (Length: 236)

Name: NF15108_low_27
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15108_low_27
NF15108_low_27
[»] scaffold0627 (1 HSPs)
scaffold0627 (9-180)||(2361-2533)
[»] scaffold0042 (2 HSPs)
scaffold0042 (181-218)||(6928-6965)
scaffold0042 (181-218)||(14340-14377)


Alignment Details
Target: scaffold0627 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: scaffold0627
Description:

Target: scaffold0627; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 9 - 180
Target Start/End: Complemental strand, 2533 - 2361
Alignment:
Q  9 ttaagttcatagcctagtttgaaaattattagaggattgaaagctttctgtttgttaaaaataaat-atgagcaccgaatttatattagtggctatgcag 107  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  2533 ttaagttcatagcctagtttgaaaattattagaggattgatagctttctgtttgttaaaaataaattatgagcaccgaatttatattagtggctatgcag 2434  T
Q  108 gatataaatcgttgatttaagaaccgtaactcttgattggatttagaatttgaaaacaataccttatctctac 180  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  2433 gatataaatcgttgatataagaaccgtaactcttgattggatttagaatttgaaaacaacaccttatctctac 2361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: scaffold0042
Description:

Target: scaffold0042; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 6965 - 6928
Alignment:
Q  181 ttcgatctagttcggactgtggggttgtaggtggttga 218  Q
    |||||| ||||||||||||||||||||||||| |||||    
T  6965 ttcgatgtagttcggactgtggggttgtaggtagttga 6928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 14377 - 14340
Alignment:
Q  181 ttcgatctagttcggactgtggggttgtaggtggttga 218  Q
    |||||| ||||||||||||||||||||||||| |||||    
T  14377 ttcgatgtagttcggactgtggggttgtaggtagttga 14340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University