View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15108_low_26 (Length: 240)

Name: NF15108_low_26
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15108_low_26
NF15108_low_26
[»] chr5 (1 HSPs)
chr5 (1-86)||(31860488-31860573)
[»] chr3 (1 HSPs)
chr3 (124-213)||(51635159-51635244)


Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 31860573 - 31860488
Alignment:
Q  1 tttgaaaagtcgaacgatagttaactgctgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca 86  Q
    |||||||| ||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31860573 tttgaaaaatcgaacgatggttaaccgccgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca 31860488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 213
Target Start/End: Original strand, 51635159 - 51635244
Alignment:
Q  124 gtgaaccggttcttgaaagtaccgcgaaccggtacgtacaaaccggggattggcagtttgctacagtgttacacgaattatgttactatg 213  Q
    |||||||||||||  |||||||||||||||||| | ||| ||||||   || || ||| ||||||||| |||||||||||||| ||||||    
T  51635159 gtgaaccggttctcaaaagtaccgcgaaccggttcatacgaaccgg---tttgcggttcgctacagtg-tacacgaattatgtgactatg 51635244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University