View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15108_low_25 (Length: 242)

Name: NF15108_low_25
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15108_low_25
NF15108_low_25
[»] scaffold0280 (1 HSPs)
scaffold0280 (7-232)||(11544-11769)


Alignment Details
Target: scaffold0280 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0280
Description:

Target: scaffold0280; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 11544 - 11769
Alignment:
Q  7 gtttgaaatgaaagaaaatggtaaaagagtagtaaatgtcagccccgaaacttcggttagagatgatagcgttgagcaagggaggaacagaatgaaggct 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11544 gtttgaaatgaaagaaaatggtaaaagagtagtaaatgtcagccccgaaacttcggttagagatgatagcgttgagcaagggaggaacagaatgaaggct 11643  T
Q  107 ttgaaggttaaattattaggttttcgtatgagaaggttaagaaaacagcgcagagctaaaatttcataccatgttaaagaagaaattaggttttcagact 206  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |    
T  11644 ttgaaggttaagttattaggttttcgtatgagaaggttaagaaaacagcgcagagctaaaatttcataccatgttaaagaagaaatttggttttcagatt 11743  T
Q  207 aagttttcatatgatcactgcctttg 232  Q
    ||||||||||||||||||||| ||||    
T  11744 aagttttcatatgatcactgcttttg 11769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University