View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15106_low_13 (Length: 242)

Name: NF15106_low_13
Description: NF15106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15106_low_13
NF15106_low_13
[»] chr2 (2 HSPs)
chr2 (97-220)||(217897-218020)
chr2 (1-77)||(217793-217871)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 97 - 220
Target Start/End: Original strand, 217897 - 218020
Alignment:
Q  97 atgaagtggtttagttagctaatgaatcaattaagtcgtccaattcattaactactatagaaatattatgatacgtttatcaaatatactagtattaaat 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  217897 atgaagtggtttagttagctaatgaatcaattaagtcgtccaattcattaactactatagaaatattatgatacgtttatcaaatatactagtattaaat 217996  T
Q  197 atgtaagtacgtgttttaattgaa 220  Q
    |||||||| |||||||||||||||    
T  217997 atgtaagtccgtgttttaattgaa 218020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 217793 - 217871
Alignment:
Q  1 tttggctttgcatat--cccttacagaaatcaaataaggattaaaattgaataaatttcgtgtaggaataaaagtctta 77  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  217793 tttggctttgcatattgcccttacagaaatcaaataaggattaaaattgaataaatttcgtgtaggaattaaagtctta 217871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University