View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15105_low_26 (Length: 203)

Name: NF15105_low_26
Description: NF15105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15105_low_26
NF15105_low_26
[»] chr8 (1 HSPs)
chr8 (18-188)||(33623049-33623219)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 33623049 - 33623219
Alignment:
Q  18 gatgcacccgagtcctcatgctatccatatccaggcgtaatacttgattctccctcaccgcgacacgccacgtgctgttcccttcctgctgcacgtgctc 117  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33623049 gatgcacccgagtcctcatgctatccatatccaggcgtaacacttgattctccctcaccgcgacacgccacgtgctgttcccttcctgctgcacgtgctc 33623148  T
Q  118 tgactctaaccctaaccctaaccttaacacttccccatttccttcctctacaccttccagtgtagccgaat 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33623149 tgactctaaccctaaccctaaccttaacacttccccatttccttcctctacaccttccagtgtagccgaat 33623219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University