View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1509_high_32 (Length: 238)

Name: NF1509_high_32
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1509_high_32
NF1509_high_32
[»] chr2 (2 HSPs)
chr2 (144-202)||(3239068-3239126)
chr2 (17-67)||(3239198-3239248)


Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 144 - 202
Target Start/End: Complemental strand, 3239126 - 3239068
Alignment:
Q  144 agccatcgaagttattattgggttgagtcattttggtggttataacttcggtcgctgga 202  Q
    ||||||||||||||||||||||||||||  |||||||| ||||||||||||||||||||    
T  3239126 agccatcgaagttattattgggttgagttgttttggtgtttataacttcggtcgctgga 3239068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 3239248 - 3239198
Alignment:
Q  17 aagtatgaaaacatttattaaagcaaaactttattttgaatcagatggagc 67  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  3239248 aagtataaaaacatttattaaagcaaaactttattttgaatcagatggagc 3239198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University