View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1508_high_17 (Length: 332)

Name: NF1508_high_17
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1508_high_17
NF1508_high_17
[»] chr4 (2 HSPs)
chr4 (18-187)||(51039565-51039734)
chr4 (257-325)||(51039795-51039863)


Alignment Details
Target: chr4 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 51039565 - 51039734
Alignment:
Q  18 acatacaagattgaggatgagagatgccaaaatgttgatgtcatcatattgaaagtgtgaaaaacatttcaagcatgcatgaaatttcagcttgagatat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  51039565 acatacaagattgaggatgagagatgccaaaatgttgatgtcatcatattgaaagtgtgaaaaacatttcaagtatgcatgaaatttcagcttgagatat 51039664  T
Q  118 gataattgaagctactccgtctagaatccaggacaagaggtccattgatttatgtttcagatacaatact 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51039665 gataattgaagctactccgtctagaatccaggacaagaggtccattgatttatgtttcagatacaatact 51039734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 257 - 325
Target Start/End: Original strand, 51039795 - 51039863
Alignment:
Q  257 tatttgattttgttatcgatgtgctgtgttctgtgggtcgtcattatgctctttgcgttgcctttgctt 325  Q
    |||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||    
T  51039795 tatttgatttagttatcgatgtgctgtgttttgtgggtcgtcattctgctctttgcgttgtctttgctt 51039863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University