View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15080_high_16 (Length: 260)

Name: NF15080_high_16
Description: NF15080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15080_high_16
NF15080_high_16
[»] chr3 (1 HSPs)
chr3 (18-245)||(41084908-41085141)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 41084908 - 41085141
Alignment:
Q  18 atagagataaaaagagagagaggggtaaggtgaaatcaccaaaatagccataatgacacgtggggtgtatattgggtgtttgaaaaaaggatgtctatga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||    
T  41084908 atagagataaaaagagagagaggggtaaggtgaaatcaccaaaatagccctaatgacacgtggggtgtatattgggggtttgaaaaaaggatgtctatga 41085007  T
Q  118 attcataatggccaagattgcttttgatacgaagtgtaaatatgaca------gggggaacgtacttaacaccaattttgtgagaagcttgaggttgtcg 211  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||    
T  41085008 attcataatggccacgattgcttttgatacgaagtgtaaatatgacaaattttgggggaacgtacttaacaccaattttgtgagaagcttgaggttgtcg 41085107  T
Q  212 ctatgtacgtcccaaccattttcaccgtggaaat 245  Q
    ||||||||||||||||||||||||||||||||||    
T  41085108 ctatgtacgtcccaaccattttcaccgtggaaat 41085141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University