View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1507_low_80 (Length: 206)

Name: NF1507_low_80
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1507_low_80
NF1507_low_80
[»] chr5 (1 HSPs)
chr5 (53-180)||(1067702-1067829)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 53 - 180
Target Start/End: Complemental strand, 1067829 - 1067702
Alignment:
Q  53 agaggttagagagagagaaagagtttcatggtgctgtttgtaacagaacagaacagaacaatgagtacctcgtgcgtgtggttttgctttttatatgttt 152  Q
    |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1067829 agaggttagagaaagagaaagagtttcacggtgctgtttgtaacagaacagaacagaacaatgagtacctcgtgcgtgtggttttgctttttatatgttt 1067730  T
Q  153 atagcagtgagtgtttttcttgtgagta 180  Q
    |||| |||||||||||||||||||||||    
T  1067729 atagtagtgagtgtttttcttgtgagta 1067702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University