View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1507_low_63 (Length: 237)

Name: NF1507_low_63
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1507_low_63
NF1507_low_63
[»] chr7 (1 HSPs)
chr7 (179-222)||(29977927-29977970)


Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 29977927 - 29977970
Alignment:
Q  179 catgtgtatgcaaggattgaagttgaaaacatagaataatttgt 222  Q
    ||||||||||||||||||||||||||||||||| ||||||||||    
T  29977927 catgtgtatgcaaggattgaagttgaaaacataaaataatttgt 29977970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University