View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1507_low_52 (Length: 255)

Name: NF1507_low_52
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1507_low_52
NF1507_low_52
[»] chr7 (2 HSPs)
chr7 (79-245)||(47201382-47201548)
chr7 (1-48)||(47201579-47201626)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 79 - 245
Target Start/End: Complemental strand, 47201548 - 47201382
Alignment:
Q  79 caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47201548 caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc 47201449  T
Q  179 caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccacccctatgcttct 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||    
T  47201448 caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccacccttatgtttct 47201382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 47201626 - 47201579
Alignment:
Q  1 aaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  47201626 aaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt 47201579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University