View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1507_high_18 (Length: 447)

Name: NF1507_high_18
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1507_high_18
NF1507_high_18
[»] chr7 (1 HSPs)
chr7 (1-376)||(6488577-6488952)


Alignment Details
Target: chr7 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 6488952 - 6488577
Alignment:
Q  1 cgaaaaaagtggcacgtgtggtagccatagcaaggttacttaatggattattggtctgcatgagatcagacctcaacaaccatgtaccgaggtcaaccat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6488952 cgaaaaaagtggcacgtgtggtagccatagcaaggttacttaatggattattggtctgcatgagatcagacctcaacaaccatgtaccgaggtcaaccat 6488853  T
Q  101 tggctcgaccgcggtagcatggaggacagcagttgatttgagaagttttttggttgggacgtgcgaaaagagtttttcgacgtcgtggaagtcgagattg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6488852 tggctcgaccgcggtagcatggaggacagcagttgatttgagaagttttttggttgggacgtgcgaaaagagtttttcgacgtcgtggaagtcgagattg 6488753  T
Q  201 gcgtcgggagggaggatggttgttaccgatgatggcagtttttggtctaaaatattagacgcaggagcgacagcgggcgaggtgagggcaggttggaacg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6488752 gcgtcgggagggaggatggttgttaccgatgatggcagtttttggtctaaaatattagacgcaggagcgacagcgggcgaggtgagggcaggttggaacg 6488653  T
Q  301 gttttgtggcagtgttgtaacggagtttccttaggattcttggtgggataactctggtggccatcaaccggtcaaa 376  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6488652 gttttgtggcagtgttgtaacggagtttccttaggattcttggtgggataactctggtggccatcaaccggtcaaa 6488577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University