View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15077_high_8 (Length: 215)

Name: NF15077_high_8
Description: NF15077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15077_high_8
NF15077_high_8
[»] chr2 (1 HSPs)
chr2 (18-206)||(34012448-34012636)


Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 34012448 - 34012636
Alignment:
Q  18 ctatgcaatctctataagtgacacgtgtatgtgtctatttatagatggttggtttctagttaccgtcaccgttatccgttgcatgacggacatgttacat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34012448 ctatgcaatctctataagtgacacgtgtatgtgtctatttatagatggttggtttctagttaccgtcaccgttatccgttgcatgacggacatgttacat 34012547  T
Q  118 ctctggaatatttggttgcagttttatattcataaacataaacgctcctcttttggcttcattcatcatggaactctttcttctcactc 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  34012548 ctctggaatatttggttgcagttttatattcataaacataaacgctcctcttttggcttcattcatcatggaactctttcttctaactc 34012636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University