View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15075_low_56 (Length: 229)

Name: NF15075_low_56
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15075_low_56
NF15075_low_56
[»] chr7 (2 HSPs)
chr7 (74-213)||(9138811-9138950)
chr7 (19-72)||(9138733-9138786)


Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 74 - 213
Target Start/End: Original strand, 9138811 - 9138950
Alignment:
Q  74 aagctgaaccatgaatcctctaactctcttgcttattttacctttctttactcagtttttggaagttgaacctgcaagaccaaaagtgctagggaaacca 173  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9138811 aagcttaaccatgaatcctctaattctcttgcttattttacctttctttactcagtttttggaagttgaacctgcaagaccaaaagtgctagggaaacca 9138910  T
Q  174 agatttcctaactctcaaatcagtgtgatgggttttgttt 213  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  9138911 agatttcctaactctcaaatcagtgtgatgggttttgttt 9138950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 9138733 - 9138786
Alignment:
Q  19 atctacccttctttcttttatccacacaccaaactcatcttcaactagtattca 72  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  9138733 atctacccttctctcttttatccacacaccaaactcatcttcaactagtattca 9138786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University