View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15074_high_9 (Length: 252)

Name: NF15074_high_9
Description: NF15074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15074_high_9
NF15074_high_9
[»] chr5 (1 HSPs)
chr5 (36-144)||(41367569-41367681)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 36 - 144
Target Start/End: Original strand, 41367569 - 41367681
Alignment:
Q  36 aataatgtttgttgttggtaataatcgatgtaa----aaagctttattgaatgttgttggaatgaaaattaaggaaaggaatcgcacatgatcaggaaca 131  Q
    |||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  41367569 aataatgtttgttgttggtaataatcgatgtaattaaaaagctttattgaatgttgttggaatgaaaattaaggaaaggaatcgcacatgatcagcaaca 41367668  T
Q  132 actttaatttgag 144  Q
    |||||||||||||    
T  41367669 actttaatttgag 41367681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University