View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15073_low_16 (Length: 214)

Name: NF15073_low_16
Description: NF15073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15073_low_16
NF15073_low_16
[»] chr7 (1 HSPs)
chr7 (10-214)||(38339271-38339475)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 214
Target Start/End: Complemental strand, 38339475 - 38339271
Alignment:
Q  10 aagaaaattaacacaattgtacaaatctttgaaagccaatccatatttcccactttgttatgattgttaatgcctaattcactattaaattgtggcttaa 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  38339475 aagaaaattaacacaattgtacaaatctttgaaagccaatccatatttcccactttgttatgattgttaatgcctaattcactattaaattgtggcctaa 38339376  T
Q  110 attttttggttactgctgtggcctaaattaaccagcttagatctctcttgtaaaaatgaaaataattatttgtcaagtgatcagaacttttaacggcttt 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  38339375 attttttggttactgctgtggcctaaattaaccagcttagatctctcttgtaaaaatgaaaataattattcgtcaagtgatcagaacttttaacggcttt 38339276  T
Q  210 aaatt 214  Q
    |||||    
T  38339275 aaatt 38339271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University