View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15073_low_13 (Length: 250)

Name: NF15073_low_13
Description: NF15073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15073_low_13
NF15073_low_13
[»] chr7 (1 HSPs)
chr7 (13-159)||(46748686-46748832)


Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 13 - 159
Target Start/End: Complemental strand, 46748832 - 46748686
Alignment:
Q  13 ggagcagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacgatttttacggagttgggaagatggtttcgctgagatggaattg 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  46748832 ggagaagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacggtttttacggagttgggaagatggtttcgctgagatggaattg 46748733  T
Q  113 gaagtggtgcaattgcggatggagaagaaaggaggtttgttatgttt 159  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||    
T  46748732 gaagtggtgcaattgcggatggagaagaaagggggtttgttatgttt 46748686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University