View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15070_high_4 (Length: 239)

Name: NF15070_high_4
Description: NF15070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15070_high_4
NF15070_high_4
[»] chr4 (1 HSPs)
chr4 (4-121)||(42656696-42656813)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 4 - 121
Target Start/End: Original strand, 42656696 - 42656813
Alignment:
Q  4 gaccgactttgtttttgattaatatctgtcgaggatctaactgaccatttttagtaaggtctcaatctacaaagcttaaacacaagaccttatctaaaaa 103  Q
    |||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42656696 gaccgactttattgttgattaatatctgtcgaggatctaactgaccacttttagtaaggtctcaatctacaaagcttaaacacaagaccttatctaaaaa 42656795  T
Q  104 tctgagttagtttcactc 121  Q
    ||||||||||||||||||    
T  42656796 tctgagttagtttcactc 42656813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University