View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1507-Insertion-24 (Length: 100)

Name: NF1507-Insertion-24
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1507-Insertion-24
NF1507-Insertion-24
[»] chr3 (6 HSPs)
chr3 (36-100)||(23406107-23406171)
chr3 (8-100)||(23464739-23464831)
chr3 (37-87)||(23480061-23480111)
chr3 (37-82)||(23448738-23448783)
chr3 (41-74)||(23455468-23455501)
chr3 (38-82)||(23500502-23500546)
[»] scaffold0201 (1 HSPs)
scaffold0201 (37-87)||(12879-12929)


Alignment Details
Target: chr3 (Bit Score: 61; Significance: 1e-26; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 36 - 100
Target Start/End: Complemental strand, 23406171 - 23406107
Alignment:
Q  36 agaattttctttaggatttcacttcctagaaaaaatagactttaattgcattgtgtgtttggtat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  23406171 agaattttctttaggatttcacttcctagaaaaaatagactttaattgcactgtgtgtttggtat 23406107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 23464831 - 23464739
Alignment:
Q  8 tcgagtatcataaaacttttcnnnnnnnagaattttctttaggatttcacttcctagaaaaaatagactttaattgcattgtgtgtttggtat 100  Q
    ||||||||||||||||||||        | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  23464831 tcgagtatcataaaacttttatttttttataattttctttaggatttcacttcctagaaaaaatagactttaattgcactgtgtgtttggtat 23464739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 37 - 87
Target Start/End: Complemental strand, 23480111 - 23480061
Alignment:
Q  37 gaattttctttaggatttcacttcctagaaaaaatagactttaattgcatt 87  Q
    |||||||| |||||||||||||||||||||||  ||||| |||||| ||||    
T  23480111 gaattttcattaggatttcacttcctagaaaatttagacattaattacatt 23480061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 23448783 - 23448738
Alignment:
Q  37 gaattttctttaggatttcacttcctagaaaaaatagactttaatt 82  Q
    ||||||||||||||||||||||||||| |||||  |||| ||||||    
T  23448783 gaattttctttaggatttcacttcctaaaaaaataagacattaatt 23448738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 74
Target Start/End: Complemental strand, 23455501 - 23455468
Alignment:
Q  41 tttctttaggatttcacttcctagaaaaaataga 74  Q
    |||||||||||||||||||| |||||||||||||    
T  23455501 tttctttaggatttcacttcgtagaaaaaataga 23455468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 82
Target Start/End: Complemental strand, 23500546 - 23500502
Alignment:
Q  38 aattttctttaggatttcacttcctagaaaaaatagactttaatt 82  Q
    |||||||||||||||||||||||||| |||||  |||| ||||||    
T  23500546 aattttctttaggatttcacttcctaaaaaaataagacattaatt 23500502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0201 (Bit Score: 31; Significance: 0.000000008; HSPs: 1)
Name: scaffold0201
Description:

Target: scaffold0201; HSP #1
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 37 - 87
Target Start/End: Complemental strand, 12929 - 12879
Alignment:
Q  37 gaattttctttaggatttcacttcctagaaaaaatagactttaattgcatt 87  Q
    |||||||||||||||||||| |||||||||||  ||||| |||||| ||||    
T  12929 gaattttctttaggatttcatttcctagaaaatttagacattaattacatt 12879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University