View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1506_low_29 (Length: 216)

Name: NF1506_low_29
Description: NF1506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1506_low_29
NF1506_low_29
[»] chr5 (1 HSPs)
chr5 (1-200)||(3268251-3268450)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 3268251 - 3268450
Alignment:
Q  1 attgaacctacaagattgttatgagaaagagaaacaaacttagttttatagcagtacctaaacaaagctgaaggtatctccccattgaaaccattctttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  3268251 attgaacctacaagattgttatgagaaagagaaacaaacttagttttatagcagtacctaaacaaagctgaaggtatctccccattgaagccattctttg 3268350  T
Q  101 ataaatctagaaaacgaatattaggcaaatcaccaatgaaatctgggatcgaaccggataacgcattggagctgaaattaatcttccacaatgagtgaag 200  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3268351 ataaatctagaaaacgaatattaggcaaatcacccatgaaatctgggatcgaaccggataacgcattggagctgaaattaatcttccacaatgagtgaag 3268450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University