View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15063_low_5 (Length: 242)

Name: NF15063_low_5
Description: NF15063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15063_low_5
NF15063_low_5
[»] chr2 (2 HSPs)
chr2 (17-127)||(3253351-3253461)
chr2 (203-232)||(3253246-3253275)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 17 - 127
Target Start/End: Complemental strand, 3253461 - 3253351
Alignment:
Q  17 ataaactttcatggaaggagccaagtgctacatgtgtgtatgtggctatatgcctattttaggattgtttactttggaattgtgattacaaagatgaatc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  3253461 ataaactttcatggaaggagccaagtgctacatgtgtgtatgtggctatatgcctatgttaggattgtttactttggaattgtgattacaaagatgaatc 3253362  T
Q  117 atggaatggaa 127  Q
    |||||||||||    
T  3253361 atggaatggaa 3253351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 203 - 232
Target Start/End: Complemental strand, 3253275 - 3253246
Alignment:
Q  203 gtatatgggctatgtatgtggattattcat 232  Q
    ||||||||||||||||||||||||||||||    
T  3253275 gtatatgggctatgtatgtggattattcat 3253246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University