View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15062_low_10 (Length: 412)

Name: NF15062_low_10
Description: NF15062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15062_low_10
NF15062_low_10
[»] chr6 (2 HSPs)
chr6 (310-385)||(5469529-5469604)
chr6 (48-98)||(5469943-5469995)


Alignment Details
Target: chr6 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 385
Target Start/End: Complemental strand, 5469604 - 5469529
Alignment:
Q  310 gaatttcagtgtgaaattcaattagctagattaatgattatggatggtttaatttattcacttgaaagaattatta 385  Q
    ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||    
T  5469604 gaatttcggtgtgaaattcaattagctagattaatgattatggatgctttaatttattcacttgaaagaataatta 5469529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 5469995 - 5469943
Alignment:
Q  48 tctcttctcacttgcatttatttatcaag--tatgtaatttgtatttagaaag 98  Q
    |||||||||||||||||||||||||||||  |||||||||||||| |||||||    
T  5469995 tctcttctcacttgcatttatttatcaagtatatgtaatttgtatctagaaag 5469943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University