View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1505_low_49 (Length: 229)

Name: NF1505_low_49
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1505_low_49
NF1505_low_49
[»] chr8 (1 HSPs)
chr8 (17-214)||(40180713-40180910)


Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 40180713 - 40180910
Alignment:
Q  17 gaaggaatagtaacatactgaaaactcatcttggagctcagaacatgaattcccaactggccagagaccagcagaagcagcaaaatgacagcttagttgc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40180713 gaaggaatagtaacatactgaaaactcatcttggagctcagaacatgaattcccaactggccagagaccagcagaagcagcaaaatgacagcttagttgc 40180812  T
Q  117 agcccttggccggcttactgatgctatcacaaaaattgctgacaagatgtagacaaactcaagagaatgaagtattcttcattgcaatcagacatagt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40180813 agcccttggccggcttactgatgctatcacaaaaattgctgacaagatgtagacaaactcaagagaatgaagtattcttcattgcaatcagacatagt 40180910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University