View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1505_high_51 (Length: 213)

Name: NF1505_high_51
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1505_high_51
NF1505_high_51
[»] chr5 (1 HSPs)
chr5 (75-196)||(24645185-24645306)
[»] chr1 (1 HSPs)
chr1 (75-196)||(52485470-52485591)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 75 - 196
Target Start/End: Complemental strand, 24645306 - 24645185
Alignment:
Q  75 atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24645306 atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa 24645207  T
Q  175 atcctcctcttcatgcaaacca 196  Q
    |||||||||||||| |||||||    
T  24645206 atcctcctcttcatccaaacca 24645185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 75 - 196
Target Start/End: Original strand, 52485470 - 52485591
Alignment:
Q  75 atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52485470 atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa 52485569  T
Q  175 atcctcctcttcatgcaaacca 196  Q
    |||||||||||||| |||||||    
T  52485570 atcctcctcttcatccaaacca 52485591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University