View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15055_low_20 (Length: 254)

Name: NF15055_low_20
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15055_low_20
NF15055_low_20
[»] chr2 (2 HSPs)
chr2 (21-169)||(26185274-26185422)
chr2 (194-233)||(26185415-26185454)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 21 - 169
Target Start/End: Original strand, 26185274 - 26185422
Alignment:
Q  21 acttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactatgttacgttgttatattactttatagtaaattatttcaacaaa 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26185274 acttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactatgttacgttgttatattactttatagtaaattatttcaacaaa 26185373  T
Q  121 catctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  26185374 catctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt 26185422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 194 - 233
Target Start/End: Original strand, 26185415 - 26185454
Alignment:
Q  194 ttagccttgcattttttatctttttatttcatatcatgtt 233  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  26185415 ttagccttgcattttttatctttttatttcatatcatgtt 26185454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University