View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15055_high_20 (Length: 237)

Name: NF15055_high_20
Description: NF15055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15055_high_20
NF15055_high_20
[»] chr8 (2 HSPs)
chr8 (1-81)||(12133175-12133255)
chr8 (142-180)||(12133316-12133354)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 12133175 - 12133255
Alignment:
Q  1 atgccactgtcaaagattgattagaataataagattgtaatagatgctgacccaagtaacctgtgcctcccacaatcaata 81  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12133175 atgccactgtcagagattgattagaataataagattgtaatagatgctgacccaagtaacctgtgcctcccacaatcaata 12133255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 142 - 180
Target Start/End: Original strand, 12133316 - 12133354
Alignment:
Q  142 acgttgtagtaattgtaatggtcaatgttttgtgtctga 180  Q
    |||||||||||||||||||||||||||||||||||||||    
T  12133316 acgttgtagtaattgtaatggtcaatgttttgtgtctga 12133354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University