View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15053_low_20 (Length: 276)

Name: NF15053_low_20
Description: NF15053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15053_low_20
NF15053_low_20
[»] chr6 (1 HSPs)
chr6 (18-258)||(32950557-32950796)


Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 32950557 - 32950796
Alignment:
Q  18 attttcttcatcttaagcctccaactgcttttacacttaagctgccttagtgatcctgggtggctggctgctttcgaacttcagttatcttagctttctg 117  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||    
T  32950557 attttcttcatcttaagcctccaactgcttttaaacttaagctgccttagcgatcctgggtggctggcttctttcgaacttca-ttatcttagctttctg 32950655  T
Q  118 ccttcggtcttcagctttctgcattctgtctttagctttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatcttcaaga 217  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32950656 ctttcggtcttcagctttctgcattctgtctttagctttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatcttcaaga 32950755  T
Q  218 ttttgaacttcagcgaaatctatctcttcaccgatcctcat 258  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  32950756 ttttgaacttcagcgaaatctatctcttcaccgatcctcat 32950796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University