View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15052_low_10 (Length: 203)

Name: NF15052_low_10
Description: NF15052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15052_low_10
NF15052_low_10
[»] chr3 (1 HSPs)
chr3 (1-54)||(37602231-37602284)
[»] chr1 (1 HSPs)
chr1 (1-54)||(46558707-46558760)
[»] chr5 (1 HSPs)
chr5 (1-54)||(22778766-22778820)
[»] scaffold0352 (1 HSPs)
scaffold0352 (129-168)||(16829-16868)
[»] chr7 (1 HSPs)
chr7 (131-159)||(27846676-27846704)


Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 37602231 - 37602284
Alignment:
Q  1 ggcctatggttatgtgactattatcatgccatcaagtgatcaaatctttttcag 54  Q
    |||||||||||| ||||||||| |||||||||||||||||||||||||||||||    
T  37602231 ggcctatggttacgtgactattgtcatgccatcaagtgatcaaatctttttcag 37602284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 46558760 - 46558707
Alignment:
Q  1 ggcctatggttatgtgactattatcatgccatcaagtgatcaaatctttttcag 54  Q
    |||||||||||| ||||||||| |||||||||||||||||||||||||||||||    
T  46558760 ggcctatggttacgtgactattgtcatgccatcaagtgatcaaatctttttcag 46558707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 22778766 - 22778820
Alignment:
Q  1 ggcctatggttatgtgactattatcatgccatcaagtgatc-aaatctttttcag 54  Q
    ||||||||| |||||||||||  |||||||||||||||||| |||||||||||||    
T  22778766 ggcctatggctatgtgactatcgtcatgccatcaagtgatcaaaatctttttcag 22778820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0352 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0352
Description:

Target: scaffold0352; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 129 - 168
Target Start/End: Complemental strand, 16868 - 16829
Alignment:
Q  129 cttctagactcaattaaataattcgaaacggacattacac 168  Q
    ||||||||||||||||||||||||||||||| | ||||||    
T  16868 cttctagactcaattaaataattcgaaacgggcgttacac 16829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 159
Target Start/End: Complemental strand, 27846704 - 27846676
Alignment:
Q  131 tctagactcaattaaataattcgaaacgg 159  Q
    |||||||||||||||||||||||||||||    
T  27846704 tctagactcaattaaataattcgaaacgg 27846676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University