View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_2D_low_36 (Length: 204)

Name: NF1504_2D_low_36
Description: NF1504_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_2D_low_36
NF1504_2D_low_36
[»] chr7 (3 HSPs)
chr7 (44-190)||(363515-363661)
chr7 (20-52)||(353342-353374)
chr7 (20-52)||(10580122-10580154)
[»] chr2 (1 HSPs)
chr2 (105-189)||(41023636-41023720)
[»] chr1 (1 HSPs)
chr1 (20-52)||(24578529-24578561)


Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 44 - 190
Target Start/End: Complemental strand, 363661 - 363515
Alignment:
Q  44 tgttttgttttacagagcacgacatcaatgagatctttggggatcttttagatgaaatttcttttttgtttattggtgattgctgtaattcaggagggct 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
T  363661 tgttttgttttacagagcacgacatcaatgagatctttggggatcttttagatgaaatttgttttttgtttattggtgattgctgtcattcaggagggct 363562  T
Q  144 ccttggtggagcccgagaggaaggtggtgtcagtaaccttctccctg 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  363561 ccttggtggagcccgagaggaaggtggtgtcagtaaccttctccctg 363515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 353342 - 353374
Alignment:
Q  20 cgacctataactcaatgatttctatgttttgtt 52  Q
    |||||||||||||||||||||||||||||||||    
T  353342 cgacctataactcaatgatttctatgttttgtt 353374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 10580122 - 10580154
Alignment:
Q  20 cgacctataactcaatgatttctatgttttgtt 52  Q
    ||||||||||||||||| |||||||||||||||    
T  10580122 cgacctataactcaatggtttctatgttttgtt 10580154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 41023636 - 41023720
Alignment:
Q  105 ttttttgtttattggtgattgctgtaattcaggagggctccttggtggagcccgagaggaaggtggtgtcagtaaccttctccct 189  Q
    |||||||||||||||||||| || |||||||||||||| |||| ||||||||  ||||| |||||||||||||||||||||||||    
T  41023636 ttttttgtttattggtgatttctataattcaggagggcacctttgtggagcctaagaggcaggtggtgtcagtaaccttctccct 41023720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 24578529 - 24578561
Alignment:
Q  20 cgacctataactcaatgatttctatgttttgtt 52  Q
    |||||||||||||||||||||||||||||||||    
T  24578529 cgacctataactcaatgatttctatgttttgtt 24578561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University