View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_low_79 (Length: 227)

Name: NF1504_1D_low_79
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_low_79
NF1504_1D_low_79
[»] chr8 (1 HSPs)
chr8 (7-189)||(31425360-31425542)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 189
Target Start/End: Complemental strand, 31425542 - 31425360
Alignment:
Q  7 tactttagaaaaccacgaaaataatattacgtacttcatgagaaaaaactaaattgttagtttgtcacaaaaataaataaattggaaccaaaacccaacc 106  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  31425542 tactttagaaaaccacgaaaataatattaggtacttcatgagaaaaaactaaattgttagtttgtcgcaaaaataaataaattggaaccaaaacccaacc 31425443  T
Q  107 acaaattattgttgattaagtatcagacgatatggtatcaacatcattaactatgaaagaatgcgacattaacgtgcaataaa 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31425442 acaaattattgttgattaagtatcagacgatatggtatcaacatcattaactatgaaagaatgcgacattaacgtgcaataaa 31425360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University