View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_low_68 (Length: 241)

Name: NF1504_1D_low_68
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_low_68
NF1504_1D_low_68
[»] chr8 (1 HSPs)
chr8 (78-145)||(10330014-10330081)


Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 78 - 145
Target Start/End: Original strand, 10330014 - 10330081
Alignment:
Q  78 gagtttggtgttggagaatactgaaatgacgatatcgaggacttggaagcattttccaaggttaagaa 145  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  10330014 gagtttggtgttggagaatactgaaatgacgacatcgaggacttggaagcattttccaaggttaagaa 10330081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University