View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_low_20 (Length: 349)

Name: NF1504_1D_low_20
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_low_20
NF1504_1D_low_20
[»] chr7 (3 HSPs)
chr7 (253-348)||(46093145-46093240)
chr7 (21-80)||(46093330-46093389)
chr7 (168-204)||(46093238-46093274)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 253 - 348
Target Start/End: Complemental strand, 46093240 - 46093145
Alignment:
Q  253 attcgattttttattgctttacgtaagacaaggattgcataaaataatgggtagcacattggttggatatgaattaagtcaaatatgctctttttt 348  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  46093240 attcgattttttattgctttacgtaagacaaggattgcataaaataatgggtagcacattggttggatatgaattaagtcaaatatactctttttt 46093145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 46093389 - 46093330
Alignment:
Q  21 catcaaatgcgataactcgacgatgatggggcaatagtgcaaatacacttttgcatggtt 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46093389 catcaaatgcgataactcgacgatgatggggcaatagtgcaaatacacttttgcatggtt 46093330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 46093274 - 46093238
Alignment:
Q  168 caaaatatttaagtttttatgataattaagcaatatt 204  Q
    |||||||||||||||||||||||||||||||||||||    
T  46093274 caaaatatttaagtttttatgataattaagcaatatt 46093238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University