View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_low_105 (Length: 203)

Name: NF1504_1D_low_105
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_low_105
NF1504_1D_low_105
[»] chr5 (1 HSPs)
chr5 (1-203)||(4395073-4395275)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 4395073 - 4395275
Alignment:
Q  1 aacattaggctcagaggaggcagataaaaaagaaagaaaataaatatactattgtgtagcaggtgatattgatgaattgcttttccaatatgggaatctg 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||    
T  4395073 aacattaggctcagaggaggcagataaaaaagaaagaaaaaaaatatactattgtgtagtaggtgatatcgatgaattgcttttccaatatgggaatctg 4395172  T
Q  101 aaaaatccagcaaagtgatcaccgatgagctatataaaatgcagaccccaagaacaagtttactagcgtcaagaccaaaacaaaatactgagttttcttc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  4395173 aaaaatccagcaaagtgatcaccgatgagctatataaaatgcagaccccaagaacaagtttactggcgtcaagaccaaaacaaaatactgagttttcttc 4395272  T
Q  201 cat 203  Q
    |||    
T  4395273 cat 4395275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University