View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_low_103 (Length: 205)

Name: NF1504_1D_low_103
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_low_103
NF1504_1D_low_103
[»] chr4 (1 HSPs)
chr4 (17-181)||(32183007-32183171)
[»] chr6 (2 HSPs)
chr6 (103-182)||(15858910-15858990)
chr6 (21-56)||(15858870-15858905)


Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 32183007 - 32183171
Alignment:
Q  17 tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32183007 tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct 32183106  T
Q  117 ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtgg 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32183107 ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtgg 32183171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 103 - 182
Target Start/End: Original strand, 15858910 - 15858990
Alignment:
Q  103 cagcagtgggtgctggttgtgggttgtt-gttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggt 182  Q
    |||||||||||||||||| |||| |||| |||  |||||||||||||||||||||||||||||||| ||||||||||||||    
T  15858910 cagcagtgggtgctggttctggggtgtttgttttagggcctgttttggtggcttgtggtgaggctgcgcgttgtttgtggt 15858990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 21 - 56
Target Start/End: Original strand, 15858870 - 15858905
Alignment:
Q  21 tgtttctgcttttgttggatggtagcagattttttg 56  Q
    ||||||||||||||||||||||||||| ||||||||    
T  15858870 tgtttctgcttttgttggatggtagcaaattttttg 15858905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University