View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15048_high_23 (Length: 219)

Name: NF15048_high_23
Description: NF15048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15048_high_23
NF15048_high_23
[»] chr8 (2 HSPs)
chr8 (35-205)||(14039046-14039216)
chr8 (11-106)||(14039181-14039276)


Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 35 - 205
Target Start/End: Complemental strand, 14039216 - 14039046
Alignment:
Q  35 acaagttcgatccagtccgggaacgagaaatctccaacaagttcgatcgagtctgggaacgagaaatctccactgcctgaggagatggatacatctgggg 134  Q
    |||||| ||||| | || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  14039216 acaagtccgatcgaatctgggaacgagaaatctccaacaagtccgatcgagtctgggaacgagaaatctccactgcctgaggagatggatatatctgggg 14039117  T
Q  135 gacatgtgaacttcacagccaacaatgttagaattggtgttattatttcttttgttttgatggtgtttttg 205  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||    
T  14039116 gacatgtgaacttcacagccaacaatgttaggattgttgttattatttcttttgttttgatggtgtttttg 14039046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 14039276 - 14039181
Alignment:
Q  11 gattatactatcactttttgtcccacaagttcgatccagtccgggaacgagaaatctccaacaagttcgatcgagtctgggaacgagaaatctcca 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||    
T  14039276 gattatactatcactttttgtcccacaagttcgatccagtccgggaacgagaaatctccaacaagtccgatcgaatctgggaacgagaaatctcca 14039181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University