View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15046_low_2 (Length: 443)

Name: NF15046_low_2
Description: NF15046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15046_low_2
NF15046_low_2
[»] chr1 (3 HSPs)
chr1 (19-289)||(45635066-45635343)
chr1 (343-429)||(45635345-45635432)
chr1 (27-100)||(41329332-41329405)
[»] chr5 (1 HSPs)
chr5 (308-370)||(34671021-34671083)
[»] chr6 (1 HSPs)
chr6 (27-87)||(20927330-20927390)


Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 45635066 - 45635343
Alignment:
Q  19 ggtacaaagatggagacaaaaacaccaaaattttccatgctttcgcctccgctagaaagaaggttaatcgtatcctttctctagagaatgatcagggtgt 118  Q
    ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45635066 ggtacaaagatggagacaaaaacaccaaatttttccatgcttccgcctccgctagaaagaaggttaatcgtatcctttctctagagaatgatcagggtgt 45635165  T
Q  119 tgaagtgaccaataattcagatatgtgtgttgtggctaaagagtattttgatgatttgtttcaacgg-------gtattcttgccccggttcttgatttt 211  Q
    | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
T  45635166 taaagtgacaaataattcagatatgtgtgttgtggctaaagagtattttgatgatttgtttcaacggaaagatagtattcttgccccggttcttgatttt 45635265  T
Q  212 attccgcagaacataacaccggaggataacacgcaacttacagctccttttacatgagaagagtttcgtgtggcttta 289  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||    
T  45635266 attccgcagaacataacaccggaggataacacgcaacttacatctccttttacacgagaagagtttcgcgtggcttta 45635343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 343 - 429
Target Start/End: Original strand, 45635345 - 45635432
Alignment:
Q  343 ttaccagcatttttggcaactttgcagcgatgatatcat-aaaggttgcagtgcttggctagaatctggacatttccctcctactctt 429  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||    
T  45635345 ttaccagcatttttggcaactttgcagcgatgatatcattaaagattgcagtgcttggctagaatccggacatttccctcctactctt 45635432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 41329332 - 41329405
Alignment:
Q  27 gatggagacaaaaacaccaaaattttccatgctttcgcctccgctagaaagaaggttaatcgtatcctttctct 100  Q
    ||||||||| | ||||||||| |||||||||||| |||  | |||||||||||||| |||| |||  |||||||    
T  41329332 gatggagaccacaacaccaaatttttccatgcttccgctacggctagaaagaaggtaaatcatattatttctct 41329405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 370
Target Start/End: Original strand, 34671021 - 34671083
Alignment:
Q  308 aaatgcccaggtcctgatggctacaacccgggtttttaccagcatttttggcaactttgcagc 370  Q
    ||||||||||||||||| || |  || || ||||||||||| |||||||||||||| ||||||    
T  34671021 aaatgcccaggtcctgacggatttaatcctggtttttaccaacatttttggcaactgtgcagc 34671083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 27 - 87
Target Start/End: Original strand, 20927330 - 20927390
Alignment:
Q  27 gatggagacaaaaacaccaaaattttccatgctttcgcctccgctagaaagaaggttaatc 87  Q
    ||||||||||| ||||||||| |||||||||||| |||  | ||||||| |||||| ||||    
T  20927330 gatggagacaacaacaccaaatttttccatgcttccgctacggctagaaggaaggtaaatc 20927390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University