View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15044_low_6 (Length: 226)

Name: NF15044_low_6
Description: NF15044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15044_low_6
NF15044_low_6
[»] chr8 (1 HSPs)
chr8 (75-155)||(433057-433137)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 75 - 155
Target Start/End: Original strand, 433057 - 433137
Alignment:
Q  75 acaaaactccaagattgcactagggaaaaaatctcaaaatctttgcaacacaagagctactcttgcatggtaacaagacca 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||    
T  433057 acaaaactccaagattgcactagggaaaaaatctcaaaatctttgcaacgcaagagctactcttgtatggtaaaaagacca 433137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University