View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15040_low_24 (Length: 275)

Name: NF15040_low_24
Description: NF15040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15040_low_24
NF15040_low_24
[»] chr3 (2 HSPs)
chr3 (120-275)||(23796732-23796884)
chr3 (1-72)||(23796933-23797004)


Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 120 - 275
Target Start/End: Complemental strand, 23796884 - 23796732
Alignment:
Q  120 gattaatgttacatgaacatctaaaaattaacatcttttcaacacttataaaaatacataacttataattaacttgaagagagacaaaataattaaaaaa 219  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  23796884 gattaatgttacatgaacatctaaaaattaacatcttttca-cacttataaaaatacataacttataactaacttgaagagagacaaaataattaaaaaa 23796786  T
Q  220 tcaaatggnnnnnnnnnnnnagataaaatgtttgtattgataagcatgattcgatc 275  Q
    ||||||||            ||||||||||||||||||||||||||||||||||||    
T  23796785 tcaaatgg--tatatatataagataaaatgtttgtattgataagcatgattcgatc 23796732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 23797004 - 23796933
Alignment:
Q  1 aatagcaacacctacctatgattttaaggatagctccttaacgttggcacctggatggacatacatcatacc 72  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23797004 aatagtaacacctacctatgattttaaggatagctccttaacgttggcacctggatggacatacatcatacc 23796933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University