View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504-Insertion-35 (Length: 178)

Name: NF1504-Insertion-35
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504-Insertion-35
NF1504-Insertion-35
[»] chr2 (2 HSPs)
chr2 (8-178)||(14782196-14782366)
chr2 (8-178)||(14774319-14774489)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 14782366 - 14782196
Alignment:
Q  8 gtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgacatcttcattaactggtggga 107  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14782366 gtttattgggtgacggttatggctaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgacatcttcattaactggtggga 14782267  T
Q  108 tttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt 178  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14782266 tttgcatgacagctttgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt 14782196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 14774489 - 14774319
Alignment:
Q  8 gtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgacatcttcattaactggtggga 107  Q
    |||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
T  14774489 gtttattgggtgacagttatggctaatgtggtgacgtggcagttttgttttatgggaactgctggaatggtgtttttgacatcttcattaactggtggga 14774390  T
Q  108 tttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt 178  Q
    |||| |||||||| ||||||||||||||||||||||| |||||| | || | |||||||||||||||||||    
T  14774389 tttgtatgacagctttgttgtctatgaatgtgttgggaggtgttttggtgtttagagatgcatttggtggt 14774319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University