View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504-Insertion-31 (Length: 142)

Name: NF1504-Insertion-31
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504-Insertion-31
NF1504-Insertion-31
[»] chr5 (1 HSPs)
chr5 (72-142)||(15164093-15164163)
[»] chr4 (2 HSPs)
chr4 (8-62)||(44184990-44185044)
chr4 (8-62)||(10420820-10420874)
[»] chr3 (1 HSPs)
chr3 (8-62)||(35341640-35341694)


Alignment Details
Target: chr5 (Bit Score: 63; Significance: 9e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 9e-28
Query Start/End: Original strand, 72 - 142
Target Start/End: Original strand, 15164093 - 15164163
Alignment:
Q  72 ttccttcatttcattcattatgttagaaacaattgcgggattggaggtttaattataggggtttttagtaa 142  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15164093 ttcctacatatcattcattatgttagaaacaattgcgggattggaggtttaattataggggtttttagtaa 15164163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 3e-18; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 44184990 - 44185044
Alignment:
Q  8 tttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt 62  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||    
T  44184990 tttgttctattccattgttatcttttggatcaaacaccgcacaacttttattgtt 44185044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 10420820 - 10420874
Alignment:
Q  8 tttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt 62  Q
    |||||| | |||||||||||||||||||||||||||| |||||| ||||| ||||    
T  10420820 tttgttctgttccattgttatcttttggatcaaacactgcacaatttttattgtt 10420874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 8e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 35341694 - 35341640
Alignment:
Q  8 tttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt 62  Q
    |||||| | ||||||||||||||||||||||||||||||||||||||||| ||||    
T  35341694 tttgttctgttccattgttatcttttggatcaaacaccgcacaacttttattgtt 35341640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University